ID: 1024077560

View in Genome Browser
Species Human (GRCh38)
Location 7:45829830-45829852
Sequence CCTCCTTTGTTATATGTGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024077551_1024077560 9 Left 1024077551 7:45829798-45829820 CCCTGACAGCCCTCCTCAGGCCC No data
Right 1024077560 7:45829830-45829852 CCTCCTTTGTTATATGTGATCGG No data
1024077553_1024077560 0 Left 1024077553 7:45829807-45829829 CCCTCCTCAGGCCCCTTCTGCAG No data
Right 1024077560 7:45829830-45829852 CCTCCTTTGTTATATGTGATCGG No data
1024077547_1024077560 19 Left 1024077547 7:45829788-45829810 CCTTAGGACCCCCTGACAGCCCT No data
Right 1024077560 7:45829830-45829852 CCTCCTTTGTTATATGTGATCGG No data
1024077550_1024077560 10 Left 1024077550 7:45829797-45829819 CCCCTGACAGCCCTCCTCAGGCC No data
Right 1024077560 7:45829830-45829852 CCTCCTTTGTTATATGTGATCGG No data
1024077546_1024077560 20 Left 1024077546 7:45829787-45829809 CCCTTAGGACCCCCTGACAGCCC No data
Right 1024077560 7:45829830-45829852 CCTCCTTTGTTATATGTGATCGG No data
1024077554_1024077560 -1 Left 1024077554 7:45829808-45829830 CCTCCTCAGGCCCCTTCTGCAGC No data
Right 1024077560 7:45829830-45829852 CCTCCTTTGTTATATGTGATCGG No data
1024077549_1024077560 11 Left 1024077549 7:45829796-45829818 CCCCCTGACAGCCCTCCTCAGGC No data
Right 1024077560 7:45829830-45829852 CCTCCTTTGTTATATGTGATCGG No data
1024077555_1024077560 -4 Left 1024077555 7:45829811-45829833 CCTCAGGCCCCTTCTGCAGCCTC No data
Right 1024077560 7:45829830-45829852 CCTCCTTTGTTATATGTGATCGG No data
1024077552_1024077560 8 Left 1024077552 7:45829799-45829821 CCTGACAGCCCTCCTCAGGCCCC No data
Right 1024077560 7:45829830-45829852 CCTCCTTTGTTATATGTGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024077560 Original CRISPR CCTCCTTTGTTATATGTGAT CGG Intergenic
No off target data available for this crispr