ID: 1024077574

View in Genome Browser
Species Human (GRCh38)
Location 7:45829907-45829929
Sequence AACCATTGGCTGATGAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024077564_1024077574 25 Left 1024077564 7:45829859-45829881 CCGAGAGCTTCATCATCCATGAT No data
Right 1024077574 7:45829907-45829929 AACCATTGGCTGATGAGTAAGGG No data
1024077568_1024077574 -4 Left 1024077568 7:45829888-45829910 CCGCCCTCTCTCCAGTCGGAACC No data
Right 1024077574 7:45829907-45829929 AACCATTGGCTGATGAGTAAGGG No data
1024077569_1024077574 -7 Left 1024077569 7:45829891-45829913 CCCTCTCTCCAGTCGGAACCATT No data
Right 1024077574 7:45829907-45829929 AACCATTGGCTGATGAGTAAGGG No data
1024077567_1024077574 -3 Left 1024077567 7:45829887-45829909 CCCGCCCTCTCTCCAGTCGGAAC No data
Right 1024077574 7:45829907-45829929 AACCATTGGCTGATGAGTAAGGG No data
1024077565_1024077574 9 Left 1024077565 7:45829875-45829897 CCATGATGAGCACCCGCCCTCTC No data
Right 1024077574 7:45829907-45829929 AACCATTGGCTGATGAGTAAGGG No data
1024077562_1024077574 27 Left 1024077562 7:45829857-45829879 CCCCGAGAGCTTCATCATCCATG No data
Right 1024077574 7:45829907-45829929 AACCATTGGCTGATGAGTAAGGG No data
1024077563_1024077574 26 Left 1024077563 7:45829858-45829880 CCCGAGAGCTTCATCATCCATGA No data
Right 1024077574 7:45829907-45829929 AACCATTGGCTGATGAGTAAGGG No data
1024077570_1024077574 -8 Left 1024077570 7:45829892-45829914 CCTCTCTCCAGTCGGAACCATTG No data
Right 1024077574 7:45829907-45829929 AACCATTGGCTGATGAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024077574 Original CRISPR AACCATTGGCTGATGAGTAA GGG Intergenic
No off target data available for this crispr