ID: 1024081737

View in Genome Browser
Species Human (GRCh38)
Location 7:45862290-45862312
Sequence TCTCCAGGAGTCACCACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024081737_1024081739 -2 Left 1024081737 7:45862290-45862312 CCAGGTGTGGTGACTCCTGGAGA No data
Right 1024081739 7:45862311-45862333 GACTTCTCAGCCATGCAGTGTGG No data
1024081737_1024081740 -1 Left 1024081737 7:45862290-45862312 CCAGGTGTGGTGACTCCTGGAGA No data
Right 1024081740 7:45862312-45862334 ACTTCTCAGCCATGCAGTGTGGG No data
1024081737_1024081742 7 Left 1024081737 7:45862290-45862312 CCAGGTGTGGTGACTCCTGGAGA No data
Right 1024081742 7:45862320-45862342 GCCATGCAGTGTGGGTGGACTGG No data
1024081737_1024081741 2 Left 1024081737 7:45862290-45862312 CCAGGTGTGGTGACTCCTGGAGA No data
Right 1024081741 7:45862315-45862337 TCTCAGCCATGCAGTGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024081737 Original CRISPR TCTCCAGGAGTCACCACACC TGG (reversed) Intergenic
No off target data available for this crispr