ID: 1024081990

View in Genome Browser
Species Human (GRCh38)
Location 7:45863771-45863793
Sequence AGACACTGACCACTGACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024081990_1024081994 19 Left 1024081990 7:45863771-45863793 CCATGGGTCAGTGGTCAGTGTCT No data
Right 1024081994 7:45863813-45863835 TAAGACAGAAGCAAACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024081990 Original CRISPR AGACACTGACCACTGACCCA TGG (reversed) Intergenic
No off target data available for this crispr