ID: 1024082458

View in Genome Browser
Species Human (GRCh38)
Location 7:45866313-45866335
Sequence AGGTCCTGAGAGAAGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024082444_1024082458 29 Left 1024082444 7:45866261-45866283 CCTCCTTTTCCTAACAGTGGCTG No data
Right 1024082458 7:45866313-45866335 AGGTCCTGAGAGAAGTGTGCAGG No data
1024082456_1024082458 -4 Left 1024082456 7:45866294-45866316 CCCTGCTGGGTGGGATGCAAGGT No data
Right 1024082458 7:45866313-45866335 AGGTCCTGAGAGAAGTGTGCAGG No data
1024082457_1024082458 -5 Left 1024082457 7:45866295-45866317 CCTGCTGGGTGGGATGCAAGGTC No data
Right 1024082458 7:45866313-45866335 AGGTCCTGAGAGAAGTGTGCAGG No data
1024082449_1024082458 20 Left 1024082449 7:45866270-45866292 CCTAACAGTGGCTGGAGGGCTGA No data
Right 1024082458 7:45866313-45866335 AGGTCCTGAGAGAAGTGTGCAGG No data
1024082454_1024082458 -3 Left 1024082454 7:45866293-45866315 CCCCTGCTGGGTGGGATGCAAGG No data
Right 1024082458 7:45866313-45866335 AGGTCCTGAGAGAAGTGTGCAGG No data
1024082446_1024082458 26 Left 1024082446 7:45866264-45866286 CCTTTTCCTAACAGTGGCTGGAG No data
Right 1024082458 7:45866313-45866335 AGGTCCTGAGAGAAGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024082458 Original CRISPR AGGTCCTGAGAGAAGTGTGC AGG Intergenic
No off target data available for this crispr