ID: 1024083234

View in Genome Browser
Species Human (GRCh38)
Location 7:45873053-45873075
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024083234_1024083243 12 Left 1024083234 7:45873053-45873075 CCCACCCTGTGGCCCTCAGCACC No data
Right 1024083243 7:45873088-45873110 CTGTGTCCCCACTTAGGCCCAGG No data
1024083234_1024083248 24 Left 1024083234 7:45873053-45873075 CCCACCCTGTGGCCCTCAGCACC No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data
1024083234_1024083244 16 Left 1024083234 7:45873053-45873075 CCCACCCTGTGGCCCTCAGCACC No data
Right 1024083244 7:45873092-45873114 GTCCCCACTTAGGCCCAGGTAGG No data
1024083234_1024083241 6 Left 1024083234 7:45873053-45873075 CCCACCCTGTGGCCCTCAGCACC No data
Right 1024083241 7:45873082-45873104 TACCTGCTGTGTCCCCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024083234 Original CRISPR GGTGCTGAGGGCCACAGGGT GGG (reversed) Intergenic