ID: 1024083235

View in Genome Browser
Species Human (GRCh38)
Location 7:45873054-45873076
Sequence TGGTGCTGAGGGCCACAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024083235_1024083241 5 Left 1024083235 7:45873054-45873076 CCACCCTGTGGCCCTCAGCACCA No data
Right 1024083241 7:45873082-45873104 TACCTGCTGTGTCCCCACTTAGG No data
1024083235_1024083248 23 Left 1024083235 7:45873054-45873076 CCACCCTGTGGCCCTCAGCACCA No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data
1024083235_1024083244 15 Left 1024083235 7:45873054-45873076 CCACCCTGTGGCCCTCAGCACCA No data
Right 1024083244 7:45873092-45873114 GTCCCCACTTAGGCCCAGGTAGG No data
1024083235_1024083243 11 Left 1024083235 7:45873054-45873076 CCACCCTGTGGCCCTCAGCACCA No data
Right 1024083243 7:45873088-45873110 CTGTGTCCCCACTTAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024083235 Original CRISPR TGGTGCTGAGGGCCACAGGG TGG (reversed) Intergenic