ID: 1024083237

View in Genome Browser
Species Human (GRCh38)
Location 7:45873058-45873080
Sequence TTCTTGGTGCTGAGGGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024083237_1024083243 7 Left 1024083237 7:45873058-45873080 CCTGTGGCCCTCAGCACCAAGAA No data
Right 1024083243 7:45873088-45873110 CTGTGTCCCCACTTAGGCCCAGG No data
1024083237_1024083248 19 Left 1024083237 7:45873058-45873080 CCTGTGGCCCTCAGCACCAAGAA No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data
1024083237_1024083241 1 Left 1024083237 7:45873058-45873080 CCTGTGGCCCTCAGCACCAAGAA No data
Right 1024083241 7:45873082-45873104 TACCTGCTGTGTCCCCACTTAGG No data
1024083237_1024083244 11 Left 1024083237 7:45873058-45873080 CCTGTGGCCCTCAGCACCAAGAA No data
Right 1024083244 7:45873092-45873114 GTCCCCACTTAGGCCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024083237 Original CRISPR TTCTTGGTGCTGAGGGCCAC AGG (reversed) Intergenic