ID: 1024083240

View in Genome Browser
Species Human (GRCh38)
Location 7:45873074-45873096
Sequence GGGACACAGCAGGTATTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024083240_1024083244 -5 Left 1024083240 7:45873074-45873096 CCAAGAAATACCTGCTGTGTCCC No data
Right 1024083244 7:45873092-45873114 GTCCCCACTTAGGCCCAGGTAGG No data
1024083240_1024083248 3 Left 1024083240 7:45873074-45873096 CCAAGAAATACCTGCTGTGTCCC No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data
1024083240_1024083243 -9 Left 1024083240 7:45873074-45873096 CCAAGAAATACCTGCTGTGTCCC No data
Right 1024083243 7:45873088-45873110 CTGTGTCCCCACTTAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024083240 Original CRISPR GGGACACAGCAGGTATTTCT TGG (reversed) Intergenic