ID: 1024083241

View in Genome Browser
Species Human (GRCh38)
Location 7:45873082-45873104
Sequence TACCTGCTGTGTCCCCACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024083239_1024083241 -7 Left 1024083239 7:45873066-45873088 CCTCAGCACCAAGAAATACCTGC No data
Right 1024083241 7:45873082-45873104 TACCTGCTGTGTCCCCACTTAGG No data
1024083234_1024083241 6 Left 1024083234 7:45873053-45873075 CCCACCCTGTGGCCCTCAGCACC No data
Right 1024083241 7:45873082-45873104 TACCTGCTGTGTCCCCACTTAGG No data
1024083235_1024083241 5 Left 1024083235 7:45873054-45873076 CCACCCTGTGGCCCTCAGCACCA No data
Right 1024083241 7:45873082-45873104 TACCTGCTGTGTCCCCACTTAGG No data
1024083238_1024083241 -6 Left 1024083238 7:45873065-45873087 CCCTCAGCACCAAGAAATACCTG No data
Right 1024083241 7:45873082-45873104 TACCTGCTGTGTCCCCACTTAGG No data
1024083232_1024083241 26 Left 1024083232 7:45873033-45873055 CCAAGTGGGCAGTTGCAGCGCCC No data
Right 1024083241 7:45873082-45873104 TACCTGCTGTGTCCCCACTTAGG No data
1024083237_1024083241 1 Left 1024083237 7:45873058-45873080 CCTGTGGCCCTCAGCACCAAGAA No data
Right 1024083241 7:45873082-45873104 TACCTGCTGTGTCCCCACTTAGG No data
1024083236_1024083241 2 Left 1024083236 7:45873057-45873079 CCCTGTGGCCCTCAGCACCAAGA No data
Right 1024083241 7:45873082-45873104 TACCTGCTGTGTCCCCACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024083241 Original CRISPR TACCTGCTGTGTCCCCACTT AGG Intergenic