ID: 1024083248

View in Genome Browser
Species Human (GRCh38)
Location 7:45873100-45873122
Sequence TTAGGCCCAGGTAGGTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024083242_1024083248 -7 Left 1024083242 7:45873084-45873106 CCTGCTGTGTCCCCACTTAGGCC No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data
1024083236_1024083248 20 Left 1024083236 7:45873057-45873079 CCCTGTGGCCCTCAGCACCAAGA No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data
1024083238_1024083248 12 Left 1024083238 7:45873065-45873087 CCCTCAGCACCAAGAAATACCTG No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data
1024083240_1024083248 3 Left 1024083240 7:45873074-45873096 CCAAGAAATACCTGCTGTGTCCC No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data
1024083237_1024083248 19 Left 1024083237 7:45873058-45873080 CCTGTGGCCCTCAGCACCAAGAA No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data
1024083239_1024083248 11 Left 1024083239 7:45873066-45873088 CCTCAGCACCAAGAAATACCTGC No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data
1024083234_1024083248 24 Left 1024083234 7:45873053-45873075 CCCACCCTGTGGCCCTCAGCACC No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data
1024083235_1024083248 23 Left 1024083235 7:45873054-45873076 CCACCCTGTGGCCCTCAGCACCA No data
Right 1024083248 7:45873100-45873122 TTAGGCCCAGGTAGGTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024083248 Original CRISPR TTAGGCCCAGGTAGGTATGC AGG Intergenic