ID: 1024087825

View in Genome Browser
Species Human (GRCh38)
Location 7:45911363-45911385
Sequence CCGGAACGTGGCAACCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024087825_1024087836 22 Left 1024087825 7:45911363-45911385 CCCAAGAGGTTGCCACGTTCCGG No data
Right 1024087836 7:45911408-45911430 CCTCGCTCCCCAGGTGCTCCAGG No data
1024087825_1024087834 13 Left 1024087825 7:45911363-45911385 CCCAAGAGGTTGCCACGTTCCGG No data
Right 1024087834 7:45911399-45911421 GACACTTGGCCTCGCTCCCCAGG No data
1024087825_1024087831 -1 Left 1024087825 7:45911363-45911385 CCCAAGAGGTTGCCACGTTCCGG No data
Right 1024087831 7:45911385-45911407 GTCCTGGATTTCCAGACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024087825 Original CRISPR CCGGAACGTGGCAACCTCTT GGG (reversed) Intergenic
No off target data available for this crispr