ID: 1024087827

View in Genome Browser
Species Human (GRCh38)
Location 7:45911364-45911386
Sequence ACCGGAACGTGGCAACCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024087827_1024087831 -2 Left 1024087827 7:45911364-45911386 CCAAGAGGTTGCCACGTTCCGGT No data
Right 1024087831 7:45911385-45911407 GTCCTGGATTTCCAGACACTTGG No data
1024087827_1024087836 21 Left 1024087827 7:45911364-45911386 CCAAGAGGTTGCCACGTTCCGGT No data
Right 1024087836 7:45911408-45911430 CCTCGCTCCCCAGGTGCTCCAGG No data
1024087827_1024087834 12 Left 1024087827 7:45911364-45911386 CCAAGAGGTTGCCACGTTCCGGT No data
Right 1024087834 7:45911399-45911421 GACACTTGGCCTCGCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024087827 Original CRISPR ACCGGAACGTGGCAACCTCT TGG (reversed) Intergenic
No off target data available for this crispr