ID: 1024087829

View in Genome Browser
Species Human (GRCh38)
Location 7:45911375-45911397
Sequence GGAAATCCAGGACCGGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024087829_1024087834 1 Left 1024087829 7:45911375-45911397 CCACGTTCCGGTCCTGGATTTCC No data
Right 1024087834 7:45911399-45911421 GACACTTGGCCTCGCTCCCCAGG No data
1024087829_1024087836 10 Left 1024087829 7:45911375-45911397 CCACGTTCCGGTCCTGGATTTCC No data
Right 1024087836 7:45911408-45911430 CCTCGCTCCCCAGGTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024087829 Original CRISPR GGAAATCCAGGACCGGAACG TGG (reversed) Intergenic
No off target data available for this crispr