ID: 1024087830

View in Genome Browser
Species Human (GRCh38)
Location 7:45911382-45911404
Sequence AGTGTCTGGAAATCCAGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024087830_1024087836 3 Left 1024087830 7:45911382-45911404 CCGGTCCTGGATTTCCAGACACT No data
Right 1024087836 7:45911408-45911430 CCTCGCTCCCCAGGTGCTCCAGG No data
1024087830_1024087834 -6 Left 1024087830 7:45911382-45911404 CCGGTCCTGGATTTCCAGACACT No data
Right 1024087834 7:45911399-45911421 GACACTTGGCCTCGCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024087830 Original CRISPR AGTGTCTGGAAATCCAGGAC CGG (reversed) Intergenic
No off target data available for this crispr