ID: 1024087831

View in Genome Browser
Species Human (GRCh38)
Location 7:45911385-45911407
Sequence GTCCTGGATTTCCAGACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024087827_1024087831 -2 Left 1024087827 7:45911364-45911386 CCAAGAGGTTGCCACGTTCCGGT No data
Right 1024087831 7:45911385-45911407 GTCCTGGATTTCCAGACACTTGG No data
1024087825_1024087831 -1 Left 1024087825 7:45911363-45911385 CCCAAGAGGTTGCCACGTTCCGG No data
Right 1024087831 7:45911385-45911407 GTCCTGGATTTCCAGACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024087831 Original CRISPR GTCCTGGATTTCCAGACACT TGG Intergenic
No off target data available for this crispr