ID: 1024087832

View in Genome Browser
Species Human (GRCh38)
Location 7:45911387-45911409
Sequence GGCCAAGTGTCTGGAAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024087832_1024087842 29 Left 1024087832 7:45911387-45911409 CCTGGATTTCCAGACACTTGGCC No data
Right 1024087842 7:45911439-45911461 GCACAACTCTCCGTGACGCTTGG No data
1024087832_1024087836 -2 Left 1024087832 7:45911387-45911409 CCTGGATTTCCAGACACTTGGCC No data
Right 1024087836 7:45911408-45911430 CCTCGCTCCCCAGGTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024087832 Original CRISPR GGCCAAGTGTCTGGAAATCC AGG (reversed) Intergenic
No off target data available for this crispr