ID: 1024087836

View in Genome Browser
Species Human (GRCh38)
Location 7:45911408-45911430
Sequence CCTCGCTCCCCAGGTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024087825_1024087836 22 Left 1024087825 7:45911363-45911385 CCCAAGAGGTTGCCACGTTCCGG No data
Right 1024087836 7:45911408-45911430 CCTCGCTCCCCAGGTGCTCCAGG No data
1024087827_1024087836 21 Left 1024087827 7:45911364-45911386 CCAAGAGGTTGCCACGTTCCGGT No data
Right 1024087836 7:45911408-45911430 CCTCGCTCCCCAGGTGCTCCAGG No data
1024087832_1024087836 -2 Left 1024087832 7:45911387-45911409 CCTGGATTTCCAGACACTTGGCC No data
Right 1024087836 7:45911408-45911430 CCTCGCTCCCCAGGTGCTCCAGG No data
1024087829_1024087836 10 Left 1024087829 7:45911375-45911397 CCACGTTCCGGTCCTGGATTTCC No data
Right 1024087836 7:45911408-45911430 CCTCGCTCCCCAGGTGCTCCAGG No data
1024087830_1024087836 3 Left 1024087830 7:45911382-45911404 CCGGTCCTGGATTTCCAGACACT No data
Right 1024087836 7:45911408-45911430 CCTCGCTCCCCAGGTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024087836 Original CRISPR CCTCGCTCCCCAGGTGCTCC AGG Intergenic
No off target data available for this crispr