ID: 1024088851

View in Genome Browser
Species Human (GRCh38)
Location 7:45919607-45919629
Sequence CACGTTGGACAGATGTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 158}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024088851_1024088860 -4 Left 1024088851 7:45919607-45919629 CCCAGTGACATCTGTCCAACGTG 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1024088860 7:45919626-45919648 CGTGATCGTTGGGGAGTTGGGGG No data
1024088851_1024088864 9 Left 1024088851 7:45919607-45919629 CCCAGTGACATCTGTCCAACGTG 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1024088864 7:45919639-45919661 GAGTTGGGGGAATTAGGATGGGG 0: 1
1: 0
2: 0
3: 31
4: 337
1024088851_1024088857 -7 Left 1024088851 7:45919607-45919629 CCCAGTGACATCTGTCCAACGTG 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1024088857 7:45919623-45919645 CAACGTGATCGTTGGGGAGTTGG No data
1024088851_1024088858 -6 Left 1024088851 7:45919607-45919629 CCCAGTGACATCTGTCCAACGTG 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1024088858 7:45919624-45919646 AACGTGATCGTTGGGGAGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 52
1024088851_1024088862 7 Left 1024088851 7:45919607-45919629 CCCAGTGACATCTGTCCAACGTG 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1024088862 7:45919637-45919659 GGGAGTTGGGGGAATTAGGATGG No data
1024088851_1024088863 8 Left 1024088851 7:45919607-45919629 CCCAGTGACATCTGTCCAACGTG 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1024088863 7:45919638-45919660 GGAGTTGGGGGAATTAGGATGGG 0: 1
1: 0
2: 2
3: 26
4: 307
1024088851_1024088861 3 Left 1024088851 7:45919607-45919629 CCCAGTGACATCTGTCCAACGTG 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1024088861 7:45919633-45919655 GTTGGGGAGTTGGGGGAATTAGG No data
1024088851_1024088859 -5 Left 1024088851 7:45919607-45919629 CCCAGTGACATCTGTCCAACGTG 0: 1
1: 0
2: 1
3: 12
4: 158
Right 1024088859 7:45919625-45919647 ACGTGATCGTTGGGGAGTTGGGG 0: 1
1: 0
2: 0
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024088851 Original CRISPR CACGTTGGACAGATGTCACT GGG (reversed) Intronic
900831347 1:4967899-4967921 CACCTTGGACACATGTCATCAGG - Intergenic
900949500 1:5850364-5850386 GACGTTAAACACATGTCACTGGG + Intergenic
905201834 1:36321307-36321329 CATGTTGGCCAGATGTGCCTGGG - Exonic
905918392 1:41701532-41701554 CACCTGGCACAGAGGTCACTTGG - Intronic
912124781 1:106522557-106522579 CACCTTGGGCAGATGTCTTTCGG - Intergenic
916624608 1:166541575-166541597 CACGTTGGGCACCTGTCATTAGG - Intergenic
917119394 1:171632468-171632490 CACCTTGGACACATGTCATTAGG + Intergenic
920047423 1:203142464-203142486 CAGGTTGGGAAGATGTCATTTGG + Intronic
922591693 1:226782235-226782257 GACTTTGCACAGATGTGACTAGG - Intergenic
923175856 1:231464223-231464245 CACCTTGGACACATGTCATCAGG - Intergenic
923407434 1:233676813-233676835 CACCTTGGACACATGTCATCAGG - Intergenic
924057874 1:240141830-240141852 CACGTTGGACAGGGCTCACATGG + Intronic
1064722254 10:18241204-18241226 CACCTTGGGCACATGTCACCAGG + Intronic
1065551596 10:26873293-26873315 GCCGTTGAACATATGTCACTGGG - Intergenic
1065791363 10:29263548-29263570 CACCTTGGACAAGTGTCACATGG - Intergenic
1066103687 10:32138946-32138968 CACCTTGGACACATGTCATCAGG + Intergenic
1070430773 10:76335536-76335558 CACCTTGGGCACATGTCATTAGG - Intronic
1070674800 10:78405202-78405224 CACATTGCACAGATGAAACTCGG + Intergenic
1071973393 10:90930774-90930796 CACCCTGGACAAATCTCACTGGG + Intergenic
1072357087 10:94622500-94622522 CACTTTGGGCACATGTCATTAGG - Intergenic
1078359142 11:10654851-10654873 CACATTGGACAGACTTCACCTGG + Intronic
1084766062 11:71309315-71309337 CACCTTGGGCATATGTCACCAGG - Intergenic
1086437035 11:86791752-86791774 CACCTTGAACAGAGGTCACAGGG - Intronic
1087050173 11:93878854-93878876 CACCTTGGACACATGTCATCAGG - Intergenic
1088795589 11:113264580-113264602 CACCTTGGGCAGAAGTCACACGG + Intronic
1093794144 12:23291190-23291212 CACATTTGACAGATGGCACTAGG + Intergenic
1094316967 12:29145765-29145787 CACGCTGCACAGATATTACTAGG - Intergenic
1096514324 12:52147858-52147880 CAGTTTGGACAGATGGCACATGG - Intergenic
1101289086 12:103348469-103348491 CATGTTGTACAGATGTCATTTGG - Intronic
1103050075 12:117771443-117771465 CACCTTGGACACATGTCATCAGG + Intronic
1104531250 12:129573002-129573024 CACATTGAAAAGATGTTACTTGG + Intronic
1108027891 13:46197532-46197554 CAGGTTGCACAGATGTCACAGGG + Intronic
1108607271 13:52052218-52052240 CACCTTGGACACATGTCATCAGG + Intronic
1111065166 13:83081518-83081540 CACCTTGGGCACATGTCATTAGG - Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1112098343 13:96159492-96159514 CACATTGGAAAGATGTGACCCGG - Intronic
1113218306 13:108069098-108069120 CACCTTGGACATATGTTTCTTGG + Intergenic
1115758159 14:36550134-36550156 TATGTAGGACAGATGTCAGTGGG - Intergenic
1116520436 14:45840136-45840158 CAAGTAGGACAGATGTAATTTGG + Intergenic
1118870847 14:69740068-69740090 CACCTTGGACACATGTCATCAGG - Intronic
1120412197 14:84172074-84172096 ACCGTTGAACATATGTCACTGGG - Intergenic
1122380746 14:101305224-101305246 CACCTTGGACACATGTCATCAGG - Intergenic
1122888078 14:104719411-104719433 CACGCTGGGCAGCTGGCACTGGG - Exonic
1124033613 15:26033281-26033303 CACCTTGGACACATGTCATCAGG - Intergenic
1125036654 15:35132946-35132968 CACGTAGGCCAGATGACACAGGG + Intergenic
1125750961 15:42028086-42028108 CACGTTACACAGATGTCAACAGG + Intronic
1126946166 15:53822954-53822976 CACCTTGGACACATGTCATTAGG - Intergenic
1130972734 15:88746787-88746809 CACGTTGGGCACATGTCATCAGG + Intergenic
1131128194 15:89874343-89874365 CACGTGAGACAGATTTCGCTAGG - Intronic
1131450580 15:92536119-92536141 CACCTTGGACACATGTCATCAGG + Intergenic
1132775835 16:1593532-1593554 CACGGCGGCCAGATGTCACGTGG - Intronic
1133820853 16:9235295-9235317 CACCTTGGACACATGTCATCAGG - Intergenic
1134348105 16:13410385-13410407 CTCATTGGGCAGATGTCTCTTGG - Intergenic
1138296640 16:55891405-55891427 CACCTTGGGCACATGTCACCAGG - Intronic
1141428997 16:83961210-83961232 CACCTTGGGCACATGTCATTAGG - Intronic
1203141022 16_KI270728v1_random:1765972-1765994 CACCTTGGCCCCATGTCACTAGG - Intergenic
1144615305 17:16766012-16766034 CACCTTGGACACATGTCATCAGG - Intronic
1144771052 17:17759847-17759869 CAAGTTGGACAGAGCCCACTAGG + Intronic
1144897397 17:18549648-18549670 CACCTTGGACACATGTCATCAGG + Intergenic
1145044297 17:19600843-19600865 GCCGTTGAACATATGTCACTGGG - Intergenic
1145134977 17:20396073-20396095 CACCTTGGACACATGTCATCAGG - Intergenic
1146779433 17:35654896-35654918 GCCGTTGAACATATGTCACTGGG + Intronic
1149660813 17:58333125-58333147 CCCGGTGGACTGATGGCACTAGG + Intergenic
1152462169 17:80447170-80447192 GACTTTGGACAGATGTCCTTGGG - Intergenic
1152462179 17:80447215-80447237 GACTTTGGACAGATGTCCTTGGG - Intergenic
1152905513 17:82968522-82968544 CACGGTGCACAGATGTCTGTCGG + Intronic
1153731045 18:8012093-8012115 CAAGTTGGAGAGACGCCACTGGG + Intronic
1154098076 18:11439466-11439488 CACCTTGGGCACATGTCATTAGG - Intergenic
1155414270 18:25580930-25580952 CACAGTGGACAGACATCACTGGG + Intergenic
1155787312 18:29916584-29916606 CACCTTGGACACATGTCATCAGG + Intergenic
1161577749 19:5064220-5064242 CAGGTTGGACAGAGGCCACCTGG - Intronic
1163279601 19:16307447-16307469 CACCTTGGACACATGTCATCAGG + Intergenic
1163678251 19:18666220-18666242 CTTGTTGGGCAGATGTCAGTGGG + Intronic
1163839496 19:19597725-19597747 CACGTTGTGCAGATGACCCTTGG + Intronic
1166824092 19:45598594-45598616 CACGTTGGGCAGATCTCACGTGG - Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
925366261 2:3314087-3314109 CACGCTGGCCATATGTCATTGGG + Intronic
925390597 2:3491479-3491501 CACGTGGGAAAGAGCTCACTGGG + Intergenic
926539951 2:14163605-14163627 CATGTTCTACAGATGTCTCTGGG - Intergenic
927947225 2:27142870-27142892 CACCTTGGGCACATGTCATTAGG + Intergenic
929742455 2:44617022-44617044 CACGTAGGACACATGTGACAAGG - Intronic
930663730 2:54081622-54081644 AACGTTGGAAATGTGTCACTAGG - Intronic
933536849 2:83585968-83585990 CACCTTGGACACATGTCATCAGG + Intergenic
939372869 2:141325243-141325265 GACTTTGGGCAGATATCACTTGG + Intronic
940988322 2:160072234-160072256 CACTTTGGGCACATGTCACCAGG - Intergenic
942931404 2:181498229-181498251 CACTTTGCTCAAATGTCACTTGG - Intronic
943753262 2:191532021-191532043 CATGTTGTAAAGATGTCCCTGGG - Intergenic
947262452 2:228238731-228238753 CCCGTTGGATAGATGTGACAAGG + Intergenic
1169443451 20:5652233-5652255 CACCTTGGGCATATGTCATTAGG + Intergenic
1170187194 20:13603959-13603981 CACAGTGATCAGATGTCACTTGG - Intronic
1173388465 20:42609908-42609930 CACATTTGTCACATGTCACTGGG - Intronic
1174296852 20:49551615-49551637 CACGTTGGGCACATGTCATCAGG + Intronic
1176104281 20:63378415-63378437 CTCGTTGTTCAGATGTCTCTGGG - Intergenic
1179153609 21:38830819-38830841 CATGGTGGACACTTGTCACTGGG + Intergenic
1185390079 22:50555164-50555186 CACCTTGGGCACATGTCATTAGG + Intronic
949729066 3:7086569-7086591 CAAGTTGCACAGAAGTCACCAGG - Intronic
950546014 3:13638449-13638471 AACGTTGTCCAGATGTCACAGGG + Intergenic
952579771 3:34819066-34819088 AACATTGGAAAGATGTCAGTAGG - Intergenic
954606691 3:51916266-51916288 CACCTTGGGCACATGTCATTAGG + Intergenic
956731411 3:72200095-72200117 CACCTTGGACACATGTCATCAGG - Intergenic
957228272 3:77476803-77476825 CACACTGCCCAGATGTCACTCGG + Intronic
957983482 3:87542690-87542712 CACGTTGGGCATATGTCATCAGG - Intergenic
960110080 3:113837401-113837423 CACCTTGGACACATGTCATTGGG - Intronic
961974576 3:131010041-131010063 CAAGTTTGCCAGATTTCACTGGG - Intronic
962375790 3:134857675-134857697 CACTTGGGACAGGTGTCACTTGG - Intronic
963896336 3:150688874-150688896 CACCTTGGGCACATGTCACCAGG + Intronic
963919480 3:150892119-150892141 CACCTTGCCCAGAAGTCACTGGG + Intronic
964023347 3:152041651-152041673 CACCTTGGACACATGTCACTGGG - Intergenic
969368340 4:6713756-6713778 CACCTTGGACACATGTCATCAGG - Intergenic
969641137 4:8399432-8399454 CACGTAGGCCAGGTGTCGCTGGG - Intronic
970918078 4:21358997-21359019 CACCTTGGGCACATGTCATTAGG + Intronic
971875765 4:32306407-32306429 CACCTTGGGCACATGTCATTTGG - Intergenic
974957129 4:68655785-68655807 CACCTTGGACACATGTCATCAGG + Intronic
977716197 4:100186523-100186545 CACCTTGGATACCTGTCACTAGG - Exonic
982322374 4:154092245-154092267 CACCTTGGGCATATGTCATTAGG - Intergenic
984096624 4:175443229-175443251 CACCTTGGGCACATGTCATTAGG - Intergenic
984751710 4:183283958-183283980 CTTGTTGGACAGATATCACACGG + Intronic
985080954 4:186263329-186263351 CACCTTGGACACATGTCATCAGG + Intergenic
989717209 5:44478368-44478390 CACCTTGGGCACATGTCACCAGG + Intergenic
992292996 5:75299520-75299542 CACCTTGGGCACATGTCATTGGG + Intergenic
993471932 5:88316863-88316885 CACCTTGGGCACATGTCACCAGG + Intergenic
996839158 5:127827668-127827690 CACATTGTACAGCTGTCTCTGGG - Intergenic
999268977 5:150285411-150285433 CACGTTGGAGAGAGGACACTGGG - Intronic
1004630693 6:17418301-17418323 GAAGTTGGAGAGATGTCTCTGGG - Intronic
1006965658 6:37981823-37981845 CACGTTGGGCACATGGCATTAGG - Intronic
1007112830 6:39322863-39322885 CAAGTTGGATAGATGTTTCTGGG + Intronic
1018664958 6:166126841-166126863 CACCATGGACAGACGTCTCTGGG - Intergenic
1020977577 7:15025729-15025751 CACCTTGGACACATGTCATCAGG + Intergenic
1023278698 7:38547657-38547679 CACCTTGGGCACATGTCATTAGG - Intronic
1024088851 7:45919607-45919629 CACGTTGGACAGATGTCACTGGG - Intronic
1024828920 7:53425390-53425412 TACGTTGGACACATGTCATTAGG - Intergenic
1026291600 7:69011355-69011377 CACCTTGGGCACATGTCACCAGG - Intergenic
1026878826 7:73895137-73895159 CACCTTGCACTGATGTCAGTGGG + Intergenic
1030877395 7:114832060-114832082 CACCTTGGGCAGATGTCATCAGG - Intergenic
1033176009 7:139124372-139124394 TACTTTGAACTGATGTCACTTGG + Intergenic
1035083135 7:156233808-156233830 CACGGTGGACAGACGCCACAGGG - Intergenic
1041388538 8:57329277-57329299 CACTATGGAGAGAGGTCACTGGG - Intergenic
1042060017 8:64806509-64806531 CACGTGGGCCAGTTGCCACTTGG + Intergenic
1042736940 8:72000148-72000170 CACTTAGTTCAGATGTCACTGGG - Intronic
1043310285 8:78850546-78850568 CCCTTTGGACAGATTTCATTAGG + Intergenic
1044222438 8:89685081-89685103 CACCTTGGACATATGTCATCAGG + Intergenic
1046222609 8:111235597-111235619 CACCTTGGGCACATGTCATTAGG + Intergenic
1046241590 8:111502647-111502669 CACCTTGGACACATGTCATCAGG - Intergenic
1046887875 8:119388268-119388290 CAAGCTGGACACTTGTCACTGGG + Intergenic
1047101952 8:121686562-121686584 CACGTTGGATAGTTGTGATTAGG + Intergenic
1047111013 8:121789588-121789610 CACCTTGGGCACATGTCACCAGG + Intergenic
1047558736 8:125963499-125963521 CACCTTGGACAAATGTCATCAGG + Intergenic
1048352096 8:133624564-133624586 CACCTTGGGCACATGTCACCAGG + Intergenic
1048408410 8:134146346-134146368 CCCGTGGGACAAATGTCCCTCGG + Intergenic
1048534715 8:135282431-135282453 CACCTCTGACAGATGTTACTAGG + Intergenic
1050386154 9:5093332-5093354 GTCGTTGAACATATGTCACTGGG - Intronic
1057147614 9:92768770-92768792 CACCTTGGGCACATGTCATTAGG - Intergenic
1062331028 9:136045034-136045056 GACCCTGGACAGATGCCACTGGG - Intronic
1186019866 X:5242410-5242432 CACCTTGGGCACATGTCATTAGG - Intergenic
1188405025 X:29797310-29797332 CACTTTGGAAAAAGGTCACTTGG - Intronic
1188905683 X:35788294-35788316 CACCTTGGGCACATGTCATTAGG + Intergenic
1190003959 X:46716857-46716879 CACCTTGTACTGAAGTCACTTGG + Intronic
1190076995 X:47324334-47324356 CACCTTGGGCACATGTCATTAGG - Intergenic
1194120157 X:89951851-89951873 CACCTTGGACATATGTCATCAGG + Intergenic
1194158310 X:90420150-90420172 CACCTTGGGCACATGTCATTAGG - Intergenic
1194200434 X:90948231-90948253 CACCTTGGGCACATGTCACTGGG + Intergenic
1194451602 X:94050579-94050601 CACCTTGGACACATGTCATCAGG - Intergenic
1194492490 X:94569045-94569067 CACCTTGGGCACATGTCACCAGG - Intergenic
1194503570 X:94706689-94706711 CACCTTGGGCAGATGTCATCAGG - Intergenic
1197043199 X:121965057-121965079 CACCTTGGACACATGTCATCAGG + Intergenic
1197568123 X:128114152-128114174 CACCTTGGGCACATGTCATTAGG - Intergenic
1199251256 X:145664871-145664893 CACCTTGGGCACATGTCACCAGG + Intergenic
1200473019 Y:3609372-3609394 CACCTTGGACATATGTCATCAGG + Intergenic
1200504635 Y:3997114-3997136 CACCTTGGGCACATGTCATTAGG - Intergenic
1200546428 Y:4524652-4524674 CACCTTGGGCACATGTCACTGGG + Intergenic
1201672793 Y:16542970-16542992 CACCTTGGACACATGTCATGAGG + Intergenic
1201943360 Y:19483310-19483332 CACATAGGGCAGATGGCACTAGG - Intergenic