ID: 1024089549

View in Genome Browser
Species Human (GRCh38)
Location 7:45923963-45923985
Sequence GAGCCCACTCCTGCTGCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024089543_1024089549 30 Left 1024089543 7:45923910-45923932 CCTTTGGTCAGCCTCGTTATTTT No data
Right 1024089549 7:45923963-45923985 GAGCCCACTCCTGCTGCTAAAGG No data
1024089545_1024089549 19 Left 1024089545 7:45923921-45923943 CCTCGTTATTTTCACCAGGTGAC No data
Right 1024089549 7:45923963-45923985 GAGCCCACTCCTGCTGCTAAAGG No data
1024089546_1024089549 5 Left 1024089546 7:45923935-45923957 CCAGGTGACCTAAACCACTCATT No data
Right 1024089549 7:45923963-45923985 GAGCCCACTCCTGCTGCTAAAGG No data
1024089548_1024089549 -9 Left 1024089548 7:45923949-45923971 CCACTCATTTCTTTGAGCCCACT No data
Right 1024089549 7:45923963-45923985 GAGCCCACTCCTGCTGCTAAAGG No data
1024089547_1024089549 -3 Left 1024089547 7:45923943-45923965 CCTAAACCACTCATTTCTTTGAG No data
Right 1024089549 7:45923963-45923985 GAGCCCACTCCTGCTGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024089549 Original CRISPR GAGCCCACTCCTGCTGCTAA AGG Intergenic
No off target data available for this crispr