ID: 1024089657

View in Genome Browser
Species Human (GRCh38)
Location 7:45924730-45924752
Sequence CTGTGTGCCTGGAGGGACGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024089652_1024089657 -8 Left 1024089652 7:45924715-45924737 CCACAGAGAGTCATTCTGTGTGC No data
Right 1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG No data
1024089649_1024089657 30 Left 1024089649 7:45924677-45924699 CCAGCTGAGAGAGGCAGGCAAGA No data
Right 1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024089657 Original CRISPR CTGTGTGCCTGGAGGGACGA GGG Intergenic
No off target data available for this crispr