ID: 1024089710

View in Genome Browser
Species Human (GRCh38)
Location 7:45925026-45925048
Sequence TTGTGAGAGAAAGCCATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024089710_1024089712 0 Left 1024089710 7:45925026-45925048 CCTGTCATGGCTTTCTCTCACAA No data
Right 1024089712 7:45925049-45925071 TAGTGCTACCTTCTACATGTGGG No data
1024089710_1024089711 -1 Left 1024089710 7:45925026-45925048 CCTGTCATGGCTTTCTCTCACAA No data
Right 1024089711 7:45925048-45925070 ATAGTGCTACCTTCTACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024089710 Original CRISPR TTGTGAGAGAAAGCCATGAC AGG (reversed) Intergenic
No off target data available for this crispr