ID: 1024089792

View in Genome Browser
Species Human (GRCh38)
Location 7:45925806-45925828
Sequence CAGTGAAAGGGATAGATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024089792_1024089798 -5 Left 1024089792 7:45925806-45925828 CCTGTTATCTATCCCTTTCACTG No data
Right 1024089798 7:45925824-45925846 CACTGGAGATGGAGAGACGGAGG No data
1024089792_1024089799 12 Left 1024089792 7:45925806-45925828 CCTGTTATCTATCCCTTTCACTG No data
Right 1024089799 7:45925841-45925863 CGGAGGCAGACCCTTTTTGCTGG No data
1024089792_1024089797 -8 Left 1024089792 7:45925806-45925828 CCTGTTATCTATCCCTTTCACTG No data
Right 1024089797 7:45925821-45925843 TTTCACTGGAGATGGAGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024089792 Original CRISPR CAGTGAAAGGGATAGATAAC AGG (reversed) Intergenic
No off target data available for this crispr