ID: 1024090425

View in Genome Browser
Species Human (GRCh38)
Location 7:45935234-45935256
Sequence CTGCATTCCATGGGAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024090421_1024090425 18 Left 1024090421 7:45935193-45935215 CCTCAAATATCTGCTCCATGCAT No data
Right 1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG No data
1024090420_1024090425 30 Left 1024090420 7:45935181-45935203 CCTTATTAGAGTCCTCAAATATC No data
Right 1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG No data
1024090422_1024090425 3 Left 1024090422 7:45935208-45935230 CCATGCATTTCATGCTAGTTTTA No data
Right 1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024090425 Original CRISPR CTGCATTCCATGGGAAAGAC AGG Intergenic
No off target data available for this crispr