ID: 1024092352

View in Genome Browser
Species Human (GRCh38)
Location 7:45954444-45954466
Sequence CTCTATTACTAGGTATCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024092352_1024092354 -1 Left 1024092352 7:45954444-45954466 CCAATAGATACCTAGTAATAGAG No data
Right 1024092354 7:45954466-45954488 GCTATTAATACTTTATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024092352 Original CRISPR CTCTATTACTAGGTATCTAT TGG (reversed) Intergenic
No off target data available for this crispr