ID: 1024092407

View in Genome Browser
Species Human (GRCh38)
Location 7:45955399-45955421
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024092407_1024092410 8 Left 1024092407 7:45955399-45955421 CCAATAGATACCTAGTAATAGAG No data
Right 1024092410 7:45955430-45955452 ACTATTCAGACAGCCACAAAGGG No data
1024092407_1024092409 7 Left 1024092407 7:45955399-45955421 CCAATAGATACCTAGTAATAGAG No data
Right 1024092409 7:45955429-45955451 TACTATTCAGACAGCCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024092407 Original CRISPR CTCTATTACTAGGTATCTAT TGG (reversed) Intergenic