ID: 1024092408

View in Genome Browser
Species Human (GRCh38)
Location 7:45955409-45955431
Sequence GTAATGATAGCTCTATTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024092408_1024092410 -2 Left 1024092408 7:45955409-45955431 CCTAGTAATAGAGCTATCATTAC No data
Right 1024092410 7:45955430-45955452 ACTATTCAGACAGCCACAAAGGG No data
1024092408_1024092409 -3 Left 1024092408 7:45955409-45955431 CCTAGTAATAGAGCTATCATTAC No data
Right 1024092409 7:45955429-45955451 TACTATTCAGACAGCCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024092408 Original CRISPR GTAATGATAGCTCTATTACT AGG (reversed) Intergenic
No off target data available for this crispr