ID: 1024093122

View in Genome Browser
Species Human (GRCh38)
Location 7:45963829-45963851
Sequence CCAAACATACACAATCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024093122_1024093126 -5 Left 1024093122 7:45963829-45963851 CCCTAAGGATTGTGTATGTTTGG No data
Right 1024093126 7:45963847-45963869 TTTGGGTGAACTTGTGTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024093122 Original CRISPR CCAAACATACACAATCCTTA GGG (reversed) Intergenic
No off target data available for this crispr