ID: 1024095506

View in Genome Browser
Species Human (GRCh38)
Location 7:45979486-45979508
Sequence GCATCTGTGGTCCTCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024095501_1024095506 -6 Left 1024095501 7:45979469-45979491 CCACCCATTGATCTCAGGCATCT No data
Right 1024095506 7:45979486-45979508 GCATCTGTGGTCCTCCTCAAGGG No data
1024095499_1024095506 16 Left 1024095499 7:45979447-45979469 CCATGATGCAGTCATGGGTTGTC No data
Right 1024095506 7:45979486-45979508 GCATCTGTGGTCCTCCTCAAGGG No data
1024095503_1024095506 -10 Left 1024095503 7:45979473-45979495 CCATTGATCTCAGGCATCTGTGG No data
Right 1024095506 7:45979486-45979508 GCATCTGTGGTCCTCCTCAAGGG No data
1024095502_1024095506 -9 Left 1024095502 7:45979472-45979494 CCCATTGATCTCAGGCATCTGTG No data
Right 1024095506 7:45979486-45979508 GCATCTGTGGTCCTCCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024095506 Original CRISPR GCATCTGTGGTCCTCCTCAA GGG Intergenic
No off target data available for this crispr