ID: 1024095642

View in Genome Browser
Species Human (GRCh38)
Location 7:45980367-45980389
Sequence TGTCAATTGAGTGGTGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024095635_1024095642 18 Left 1024095635 7:45980326-45980348 CCACACAGGGCAGACATCCTCCA No data
Right 1024095642 7:45980367-45980389 TGTCAATTGAGTGGTGGGCAAGG No data
1024095637_1024095642 1 Left 1024095637 7:45980343-45980365 CCTCCACGTGGCTTCAGCTGCAG No data
Right 1024095642 7:45980367-45980389 TGTCAATTGAGTGGTGGGCAAGG No data
1024095634_1024095642 24 Left 1024095634 7:45980320-45980342 CCTCAGCCACACAGGGCAGACAT No data
Right 1024095642 7:45980367-45980389 TGTCAATTGAGTGGTGGGCAAGG No data
1024095638_1024095642 -2 Left 1024095638 7:45980346-45980368 CCACGTGGCTTCAGCTGCAGCTG No data
Right 1024095642 7:45980367-45980389 TGTCAATTGAGTGGTGGGCAAGG No data
1024095633_1024095642 25 Left 1024095633 7:45980319-45980341 CCCTCAGCCACACAGGGCAGACA No data
Right 1024095642 7:45980367-45980389 TGTCAATTGAGTGGTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024095642 Original CRISPR TGTCAATTGAGTGGTGGGCA AGG Intergenic
No off target data available for this crispr