ID: 1024104145

View in Genome Browser
Species Human (GRCh38)
Location 7:46064742-46064764
Sequence TCAGATTCACTGCTAGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024104145_1024104148 6 Left 1024104145 7:46064742-46064764 CCAGATTCTAGCAGTGAATCTGA No data
Right 1024104148 7:46064771-46064793 GGCTTAGTGAAGTCTCATGGAGG No data
1024104145_1024104149 15 Left 1024104145 7:46064742-46064764 CCAGATTCTAGCAGTGAATCTGA No data
Right 1024104149 7:46064780-46064802 AAGTCTCATGGAGGAAGCTTAGG No data
1024104145_1024104147 3 Left 1024104145 7:46064742-46064764 CCAGATTCTAGCAGTGAATCTGA No data
Right 1024104147 7:46064768-46064790 AAAGGCTTAGTGAAGTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024104145 Original CRISPR TCAGATTCACTGCTAGAATC TGG (reversed) Intergenic
No off target data available for this crispr