ID: 1024104147

View in Genome Browser
Species Human (GRCh38)
Location 7:46064768-46064790
Sequence AAAGGCTTAGTGAAGTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024104145_1024104147 3 Left 1024104145 7:46064742-46064764 CCAGATTCTAGCAGTGAATCTGA No data
Right 1024104147 7:46064768-46064790 AAAGGCTTAGTGAAGTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024104147 Original CRISPR AAAGGCTTAGTGAAGTCTCA TGG Intergenic
No off target data available for this crispr