ID: 1024104696

View in Genome Browser
Species Human (GRCh38)
Location 7:46071180-46071202
Sequence CTACCGTCCTTGGGGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024104692_1024104696 -2 Left 1024104692 7:46071159-46071181 CCTCTTTCTAAAAATTACAAGCT No data
Right 1024104696 7:46071180-46071202 CTACCGTCCTTGGGGAAAGCTGG No data
1024104691_1024104696 8 Left 1024104691 7:46071149-46071171 CCTATTCAAGCCTCTTTCTAAAA No data
Right 1024104696 7:46071180-46071202 CTACCGTCCTTGGGGAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024104696 Original CRISPR CTACCGTCCTTGGGGAAAGC TGG Intergenic
No off target data available for this crispr