ID: 1024105404

View in Genome Browser
Species Human (GRCh38)
Location 7:46079588-46079610
Sequence CTTTATACCCTGAGGGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024105395_1024105404 25 Left 1024105395 7:46079540-46079562 CCCACTTTGCACCACAGCTGGGA No data
Right 1024105404 7:46079588-46079610 CTTTATACCCTGAGGGTAACTGG No data
1024105398_1024105404 14 Left 1024105398 7:46079551-46079573 CCACAGCTGGGAGACACTGGAAG No data
Right 1024105404 7:46079588-46079610 CTTTATACCCTGAGGGTAACTGG No data
1024105396_1024105404 24 Left 1024105396 7:46079541-46079563 CCACTTTGCACCACAGCTGGGAG No data
Right 1024105404 7:46079588-46079610 CTTTATACCCTGAGGGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024105404 Original CRISPR CTTTATACCCTGAGGGTAAC TGG Intergenic
No off target data available for this crispr