ID: 1024109479

View in Genome Browser
Species Human (GRCh38)
Location 7:46130808-46130830
Sequence TGTGGTGGCCGCGGAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024109479_1024109485 -3 Left 1024109479 7:46130808-46130830 CCCTCTTCTCCGCGGCCACCACA No data
Right 1024109485 7:46130828-46130850 ACATCATGTTGTCTGAACTTGGG No data
1024109479_1024109486 -2 Left 1024109479 7:46130808-46130830 CCCTCTTCTCCGCGGCCACCACA No data
Right 1024109486 7:46130829-46130851 CATCATGTTGTCTGAACTTGGGG No data
1024109479_1024109484 -4 Left 1024109479 7:46130808-46130830 CCCTCTTCTCCGCGGCCACCACA No data
Right 1024109484 7:46130827-46130849 CACATCATGTTGTCTGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024109479 Original CRISPR TGTGGTGGCCGCGGAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr