ID: 1024110820

View in Genome Browser
Species Human (GRCh38)
Location 7:46144831-46144853
Sequence TCTCCTCTTTAGATGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024110820_1024110824 -8 Left 1024110820 7:46144831-46144853 CCCTCCACCATCTAAAGAGGAGA No data
Right 1024110824 7:46144846-46144868 AGAGGAGATAGCCAAGAAATTGG No data
1024110820_1024110825 -7 Left 1024110820 7:46144831-46144853 CCCTCCACCATCTAAAGAGGAGA No data
Right 1024110825 7:46144847-46144869 GAGGAGATAGCCAAGAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024110820 Original CRISPR TCTCCTCTTTAGATGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr