ID: 1024111095

View in Genome Browser
Species Human (GRCh38)
Location 7:46146802-46146824
Sequence ATGGCTTTAACTAGACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024111091_1024111095 24 Left 1024111091 7:46146755-46146777 CCAAGAAAATAACCTCTGAACAG No data
Right 1024111095 7:46146802-46146824 ATGGCTTTAACTAGACTGGAAGG No data
1024111092_1024111095 12 Left 1024111092 7:46146767-46146789 CCTCTGAACAGAATGTGAGTGAT No data
Right 1024111095 7:46146802-46146824 ATGGCTTTAACTAGACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024111095 Original CRISPR ATGGCTTTAACTAGACTGGA AGG Intergenic