ID: 1024115193

View in Genome Browser
Species Human (GRCh38)
Location 7:46186253-46186275
Sequence AGATATCCTGGCTCTTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024115190_1024115193 14 Left 1024115190 7:46186216-46186238 CCTAGCTTTCTCTGGTTATATTT No data
Right 1024115193 7:46186253-46186275 AGATATCCTGGCTCTTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024115193 Original CRISPR AGATATCCTGGCTCTTAAGT TGG Intergenic
No off target data available for this crispr