ID: 1024115195

View in Genome Browser
Species Human (GRCh38)
Location 7:46186263-46186285
Sequence GCTCTTAAGTTGGTTGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024115190_1024115195 24 Left 1024115190 7:46186216-46186238 CCTAGCTTTCTCTGGTTATATTT No data
Right 1024115195 7:46186263-46186285 GCTCTTAAGTTGGTTGCATGTGG No data
1024115192_1024115195 -4 Left 1024115192 7:46186244-46186266 CCAAAAGTTAGATATCCTGGCTC No data
Right 1024115195 7:46186263-46186285 GCTCTTAAGTTGGTTGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024115195 Original CRISPR GCTCTTAAGTTGGTTGCATG TGG Intergenic
No off target data available for this crispr