ID: 1024118297

View in Genome Browser
Species Human (GRCh38)
Location 7:46213147-46213169
Sequence CTGAAGACAGAGTTGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024118291_1024118297 0 Left 1024118291 7:46213124-46213146 CCACTCAACACCCAGTAGCTGGT No data
Right 1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG No data
1024118292_1024118297 -10 Left 1024118292 7:46213134-46213156 CCCAGTAGCTGGTCTGAAGACAG No data
Right 1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG No data
1024118289_1024118297 18 Left 1024118289 7:46213106-46213128 CCTCAGTGGCTGTTTGTGCCACT No data
Right 1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024118297 Original CRISPR CTGAAGACAGAGTTGGAGAG GGG Intergenic
No off target data available for this crispr