ID: 1024118479

View in Genome Browser
Species Human (GRCh38)
Location 7:46214485-46214507
Sequence TGCTCTGGCCCCAGTACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024118479_1024118484 16 Left 1024118479 7:46214485-46214507 CCAGATGTACTGGGGCCAGAGCA No data
Right 1024118484 7:46214524-46214546 GCAGATCCTGTCCCCAGCACAGG No data
1024118479_1024118487 27 Left 1024118479 7:46214485-46214507 CCAGATGTACTGGGGCCAGAGCA No data
Right 1024118487 7:46214535-46214557 CCCCAGCACAGGATCCCAGATGG No data
1024118479_1024118481 -7 Left 1024118479 7:46214485-46214507 CCAGATGTACTGGGGCCAGAGCA No data
Right 1024118481 7:46214501-46214523 CAGAGCAGAAATGAGACCTCTGG No data
1024118479_1024118482 -6 Left 1024118479 7:46214485-46214507 CCAGATGTACTGGGGCCAGAGCA No data
Right 1024118482 7:46214502-46214524 AGAGCAGAAATGAGACCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024118479 Original CRISPR TGCTCTGGCCCCAGTACATC TGG (reversed) Intergenic
No off target data available for this crispr