ID: 1024127839

View in Genome Browser
Species Human (GRCh38)
Location 7:46318891-46318913
Sequence GTCTCATACTAGGCATATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024127836_1024127839 29 Left 1024127836 7:46318839-46318861 CCAGACACATTGCTAAGTATGGT No data
Right 1024127839 7:46318891-46318913 GTCTCATACTAGGCATATACAGG No data
1024127837_1024127839 -2 Left 1024127837 7:46318870-46318892 CCATTAAATTTAGTATTTTTAGT No data
Right 1024127839 7:46318891-46318913 GTCTCATACTAGGCATATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024127839 Original CRISPR GTCTCATACTAGGCATATAC AGG Intergenic
No off target data available for this crispr