ID: 1024140658

View in Genome Browser
Species Human (GRCh38)
Location 7:46460110-46460132
Sequence ACTTGGTCCTGGAGTGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024140658_1024140665 17 Left 1024140658 7:46460110-46460132 CCCTGTTCACTCCAGGACCAAGT No data
Right 1024140665 7:46460150-46460172 AGCTCCTTTGCTCCAGAGTCTGG No data
1024140658_1024140661 -9 Left 1024140658 7:46460110-46460132 CCCTGTTCACTCCAGGACCAAGT No data
Right 1024140661 7:46460124-46460146 GGACCAAGTACCACACAACTAGG No data
1024140658_1024140662 -8 Left 1024140658 7:46460110-46460132 CCCTGTTCACTCCAGGACCAAGT No data
Right 1024140662 7:46460125-46460147 GACCAAGTACCACACAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024140658 Original CRISPR ACTTGGTCCTGGAGTGAACA GGG (reversed) Intergenic
No off target data available for this crispr