ID: 1024143893

View in Genome Browser
Species Human (GRCh38)
Location 7:46491505-46491527
Sequence CTGTGGTAAAAATCCAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024143887_1024143893 18 Left 1024143887 7:46491464-46491486 CCAAAGAATAGCCATGATGTGGC No data
Right 1024143893 7:46491505-46491527 CTGTGGTAAAAATCCAGGAAAGG No data
1024143888_1024143893 7 Left 1024143888 7:46491475-46491497 CCATGATGTGGCAAAAGTCAAGC No data
Right 1024143893 7:46491505-46491527 CTGTGGTAAAAATCCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024143893 Original CRISPR CTGTGGTAAAAATCCAGGAA AGG Intergenic
No off target data available for this crispr