ID: 1024146353

View in Genome Browser
Species Human (GRCh38)
Location 7:46521646-46521668
Sequence CCTAAGGAAGAGCAGTAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024146348_1024146353 8 Left 1024146348 7:46521615-46521637 CCTCCTAGGTAATTGGGTATTTA No data
Right 1024146353 7:46521646-46521668 CCTAAGGAAGAGCAGTAAATGGG No data
1024146349_1024146353 5 Left 1024146349 7:46521618-46521640 CCTAGGTAATTGGGTATTTAAGC No data
Right 1024146353 7:46521646-46521668 CCTAAGGAAGAGCAGTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024146353 Original CRISPR CCTAAGGAAGAGCAGTAAAT GGG Intergenic
No off target data available for this crispr