ID: 1024146662

View in Genome Browser
Species Human (GRCh38)
Location 7:46523671-46523693
Sequence GGTTCAAATGTGCCCCCGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024146662_1024146670 8 Left 1024146662 7:46523671-46523693 CCCAACGGGGGCACATTTGAACC No data
Right 1024146670 7:46523702-46523724 TTGATATTGGGTGCTGAGCAGGG No data
1024146662_1024146665 -5 Left 1024146662 7:46523671-46523693 CCCAACGGGGGCACATTTGAACC No data
Right 1024146665 7:46523689-46523711 GAACCTTGCCAGGTTGATATTGG No data
1024146662_1024146673 17 Left 1024146662 7:46523671-46523693 CCCAACGGGGGCACATTTGAACC No data
Right 1024146673 7:46523711-46523733 GGTGCTGAGCAGGGTGGCTAGGG No data
1024146662_1024146672 16 Left 1024146662 7:46523671-46523693 CCCAACGGGGGCACATTTGAACC No data
Right 1024146672 7:46523710-46523732 GGGTGCTGAGCAGGGTGGCTAGG No data
1024146662_1024146671 11 Left 1024146662 7:46523671-46523693 CCCAACGGGGGCACATTTGAACC No data
Right 1024146671 7:46523705-46523727 ATATTGGGTGCTGAGCAGGGTGG No data
1024146662_1024146669 7 Left 1024146662 7:46523671-46523693 CCCAACGGGGGCACATTTGAACC No data
Right 1024146669 7:46523701-46523723 GTTGATATTGGGTGCTGAGCAGG No data
1024146662_1024146666 -4 Left 1024146662 7:46523671-46523693 CCCAACGGGGGCACATTTGAACC No data
Right 1024146666 7:46523690-46523712 AACCTTGCCAGGTTGATATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024146662 Original CRISPR GGTTCAAATGTGCCCCCGTT GGG (reversed) Intergenic
No off target data available for this crispr