ID: 1024149681

View in Genome Browser
Species Human (GRCh38)
Location 7:46558311-46558333
Sequence TTTGGTCCTGTTTCAATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024149681_1024149687 26 Left 1024149681 7:46558311-46558333 CCACTCATTGAAACAGGACCAAA No data
Right 1024149687 7:46558360-46558382 GTGAATATAGAAGAAGGAAAGGG No data
1024149681_1024149685 20 Left 1024149681 7:46558311-46558333 CCACTCATTGAAACAGGACCAAA No data
Right 1024149685 7:46558354-46558376 GTATTTGTGAATATAGAAGAAGG No data
1024149681_1024149686 25 Left 1024149681 7:46558311-46558333 CCACTCATTGAAACAGGACCAAA No data
Right 1024149686 7:46558359-46558381 TGTGAATATAGAAGAAGGAAAGG No data
1024149681_1024149683 -4 Left 1024149681 7:46558311-46558333 CCACTCATTGAAACAGGACCAAA No data
Right 1024149683 7:46558330-46558352 CAAACTTCCTTTACTCAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024149681 Original CRISPR TTTGGTCCTGTTTCAATGAG TGG (reversed) Intergenic
No off target data available for this crispr