ID: 1024149684

View in Genome Browser
Species Human (GRCh38)
Location 7:46558337-46558359
Sequence AAATACTCCACATTGAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024149684_1024149686 -1 Left 1024149684 7:46558337-46558359 CCTTTACTCAATGTGGAGTATTT No data
Right 1024149686 7:46558359-46558381 TGTGAATATAGAAGAAGGAAAGG No data
1024149684_1024149687 0 Left 1024149684 7:46558337-46558359 CCTTTACTCAATGTGGAGTATTT No data
Right 1024149687 7:46558360-46558382 GTGAATATAGAAGAAGGAAAGGG No data
1024149684_1024149688 6 Left 1024149684 7:46558337-46558359 CCTTTACTCAATGTGGAGTATTT No data
Right 1024149688 7:46558366-46558388 ATAGAAGAAGGAAAGGGCCATGG No data
1024149684_1024149685 -6 Left 1024149684 7:46558337-46558359 CCTTTACTCAATGTGGAGTATTT No data
Right 1024149685 7:46558354-46558376 GTATTTGTGAATATAGAAGAAGG No data
1024149684_1024149690 12 Left 1024149684 7:46558337-46558359 CCTTTACTCAATGTGGAGTATTT No data
Right 1024149690 7:46558372-46558394 GAAGGAAAGGGCCATGGGACAGG No data
1024149684_1024149689 7 Left 1024149684 7:46558337-46558359 CCTTTACTCAATGTGGAGTATTT No data
Right 1024149689 7:46558367-46558389 TAGAAGAAGGAAAGGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024149684 Original CRISPR AAATACTCCACATTGAGTAA AGG (reversed) Intergenic
No off target data available for this crispr