ID: 1024149690

View in Genome Browser
Species Human (GRCh38)
Location 7:46558372-46558394
Sequence GAAGGAAAGGGCCATGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024149684_1024149690 12 Left 1024149684 7:46558337-46558359 CCTTTACTCAATGTGGAGTATTT No data
Right 1024149690 7:46558372-46558394 GAAGGAAAGGGCCATGGGACAGG No data
1024149682_1024149690 20 Left 1024149682 7:46558329-46558351 CCAAACTTCCTTTACTCAATGTG No data
Right 1024149690 7:46558372-46558394 GAAGGAAAGGGCCATGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024149690 Original CRISPR GAAGGAAAGGGCCATGGGAC AGG Intergenic
No off target data available for this crispr