ID: 1024153707

View in Genome Browser
Species Human (GRCh38)
Location 7:46599171-46599193
Sequence CCAGTGTCCCCAAGCCCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024153707_1024153713 6 Left 1024153707 7:46599171-46599193 CCACGAGGGCTTGGGGACACTGG No data
Right 1024153713 7:46599200-46599222 ATACAATCTGGCCTTCTCTCAGG No data
1024153707_1024153718 25 Left 1024153707 7:46599171-46599193 CCACGAGGGCTTGGGGACACTGG No data
Right 1024153718 7:46599219-46599241 CAGGAAGGGCAGGCATTAAATGG No data
1024153707_1024153716 15 Left 1024153707 7:46599171-46599193 CCACGAGGGCTTGGGGACACTGG No data
Right 1024153716 7:46599209-46599231 GGCCTTCTCTCAGGAAGGGCAGG No data
1024153707_1024153709 -6 Left 1024153707 7:46599171-46599193 CCACGAGGGCTTGGGGACACTGG No data
Right 1024153709 7:46599188-46599210 CACTGGATCCCCATACAATCTGG No data
1024153707_1024153714 10 Left 1024153707 7:46599171-46599193 CCACGAGGGCTTGGGGACACTGG No data
Right 1024153714 7:46599204-46599226 AATCTGGCCTTCTCTCAGGAAGG No data
1024153707_1024153715 11 Left 1024153707 7:46599171-46599193 CCACGAGGGCTTGGGGACACTGG No data
Right 1024153715 7:46599205-46599227 ATCTGGCCTTCTCTCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024153707 Original CRISPR CCAGTGTCCCCAAGCCCTCG TGG (reversed) Intergenic
No off target data available for this crispr